Principle
Fungal Identification Kit is based on PCR amplification of the fungal 26S rDNA D1/D2 region or the entire ITS sequence, according to sequencing analysis of the PCR amplified DNA fragment, fungal species can be identified. The 26S rDNA of fungi is divided into D1-D12 and other regions, among which the D1/D2 region has a sequence length of 500-600bp. The D1/D2 region sequences of most known yeast species model strains have been determined. The ITS, including ITS1 and ITS2, has a total length of 300-1000 bp.
This kit contains all the reagents needed for the amplification of the fungal 26S rDNA D1/D2 region and the ITS region. The PCR amplification primers D F/R are used to amplify the DNA fragment of the fungal 26S rDNA D1/D2 region, and the ITS F/R are used to amplify the DNA fragment of the fungal ITS region. At the same time, two sequencing primers are provided, including the forward sequencing primer Seq F and the reverse sequencing primer Seq R.
Components
|
Item |
100RNX |
|
2X Taq PCR Mix |
2×1.5mL |
|
PCR Primers: |
|
|
D F (10 µM) |
50 µL |
|
D R (10 µM) |
50 µL |
|
ITS F (10 µM) |
50 µL |
|
ITS R (10 µM) |
50 µL |
|
Seq Primers |
|
|
Seq F (10 µM) |
50 µL |
|
Seq R (10 µM) |
50 µL |
|
Positive Control(1ng/µL) |
50 µL |
|
Sterilized ddH2O |
4×1.0mL |
Sequencing primers
|
Item |
Sequence |
|
Seq R |
GAGCGGATAACAATTTCACACAGG |
|
Seq F |
GAGCGGATAACAATTTCACACAGG |
Store: 20℃.
